Sample exemplar is used here. Please input exemplar name in the text box below and press "Change" to view it.
|
Maize 18K GeneChip Exemplar: Zm.10134.1.A1_at
|
Name
|
|
---|
Date last modified
| 2005-02-22 |
---|
Sequence Type | Consensus sequence from Zm.10134.1
|
---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Zm.10134.1.A1_at: 1. Zm.10134.1.A1_at: Expression Details Probe-Level Intensity |
---|
Rice Genome Alignment | Genome Alignment at Gramene
On the Gramene entry page, under the "Location of hits" section, select one of the locations to go to the genome browser (ContigView) page, then under "Detailed view" section, select "arrays" menu and check the platforms to be displayed. |
---|
BLAST and EST alignment Plant Sequence BLAST | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
---|
Annotation | 1. BEST BLASTX UniProt: Q9ZP60, GST7 protein (EC 2.5.1.18) Length = 227, Expect:9e-98. match=167/226 aa. more
2. BEST BLASTN TIGR Maize Gene Index: TC252847, similar to UP|Q9ZP60 (Q9ZP60) GST7 protein , complete Length = 860, Expect: 0, match=763/767. It may represent same contig. more
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_15264, Contig15264 (6 members) from HarvEST Triticeae v. 1.03 assembly 25 [Hordeum vulgare] Length = 1015, Expect= 4e-87, match=77/136 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 266296_at, |At2g29420 putative glutathione S-transferase supported by full-length cDNA: Ceres:24361. Length = 684, Expect= 3e-53, match=55/105 aa. more
5. BEST BLASTN CornChip0 GeneChip Exemplar: Zm3.246.1.A1_at, Zm3.246.1.A1_a. (510 letters), Expect= 3e-33, match=268/334 base. more
6. BEST BLASTN Maize 58K Oligo Array Element: MZ00017926, TC225598 Length = 860, Expect= 0, match=763/767 base. more |
---|
Nucleotide Sequence | Total length: 881 >Zm.10134.1.A1_at gb|BQ619055 cccgggctgcaggaattcggcannngaagaaacntgtcttcttcacctgttaagatcatc ggccattcggtaagcccattctcgcaccgcgtcgaggccgctctgcggctcaagggcgtg ccgtatgagctgatccaggaagacctgagcaacaagagcgagctgctgctcgccaaaaan cctgtccacaagaaggtgcccgtgctcctccatgccgatcgtgccatctgtgagtccctc gtcatcgtcgagtacgtcgacgagacnttcgacgggccgtccctcctcccggccgacccc cacgaccgtgccacggcccgtttctgggcagacttcatggacaggaagctccngaagccg ttctggctggcgcactggacagagggcgacgcgcagaaggctcaggtggaagaggccaag cagaagctggcgctcatggaggcgcagctcgacgggaggaggttcttcgggggcgacacc gtcggctacgtcgacatcgcagcctgcgtgctagctccttggctcagcgtcgtagaggag gtgactggagtggccgtggttgacgaaggtgagttccctgctctgcgccgttggtccaga gagtacagctcctgcgaagctctcaagcagtgcgtcccggacagggaccagctcgtcgcc ttctatactgaaaggaaggaggcgtacaaagtgttcgctaatgcatggttgcagcagtag tttggttttgtgtgtggaataataatgtatggatcacagattgtctgtgctgaaataaca gtaatgagcctagnnananaannaaannnnnaaaaannnnnnnnnnnnnggnnnnctacc aatttccccagtaaaatnntntttaaggngggggcgcccnc
|