ATH1-121501 GeneChip Exemplar: 250434_at
|
Name
| 
|
|---|
Date last modified
| 2004-12-20 |
|---|
Sequence Type
| Exemplar from At5g10390 with annotation provided by www.tigr.org
|
|---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from 250434_at:
1. 250434_at: Expression Details Probe-Level Intensity
|
|---|
BLAST and EST alignment
Plant Sequence BLAST | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
|---|
| Annotation | "'histone H3 - like protein histone H3, Arabidopsis thaliana, PIR:S06250'"
1. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_00014, Contig1. (5 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (641 letters), Expect= 5e-85, match=136/137 aa.
|
|---|
BLAST Details |
TBLASTX vs Barley1 Exemplars | | # | Species | Subject Sequence Description | Expect | Identity/Match | Identity% | HSP
Details | | 1 | barley | Barley1_00014: Contig1. (5 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (641 letters) | 5e-85 | 136/137 | 99 | View | | 2 | barley | Barley1_00082: Contig8. (6 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (575 letters) | 5e-85 | 136/137 | 99 | View | | 3 | barley | Barley1_00105: Contig10. (17 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (618 letters) | 6e-85 | 136/137 | 99 | View | | 4 | barley | Barley1_00106: Contig10. (17 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (653 letters) | 6e-85 | 136/137 | 99 | View | | 5 | barley | Barley1_00124: Contig12. (10 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (634 letters) | 6e-85 | 136/137 | 99 | View |
|
|---|
| Nucleotide Sequence |
Total length: 411
> at|At5g10390; histone H3 - like protein histone H3, Arabidopsis thaliana, PIR:S06250
atggctcgtactaagcaaaccgcgaggaaatccacaggaggcaaagcaccaagaaagcaa
ctcgcaaccaaggcggcaaggaaatctgctccggccaccggaggagtgaagaagccgcat
agattccgtccaggaactgttgccttgagagagatcaggaagtatcagaagagcactgag
cttctgatccgtaagcttcctttccagcgtctggttcgtgagatagctcaggatttcaag
acggatctgaggtttcagagcagtgctgttgctgctttacaagaggctgctgaggcttac
cttgttggtttgtttgaagacactaatctttgcgccattcacgctaagagggtcaccatc
atgcctaaggatatccagctcgcgaggagaatcagaggagaaagagcttga
|
|---|